Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ848696
Length 612 bp
Fasta Format > whsctal10k23
aaaaggttcgagtgcgttcgagagtgaggagtgagaagagatggctccgg tgaagctgtacggcgcgaccctgtcgtggaacgtcaccaggtgcgtggcg gcgctggaggaagccggcgtcgagtacgagctcgtccccatcaacttcgg caccggcgagcacaagggccccgaccacctcgccaggaacccctttggcc aggtgccagctttgcaggatggtgacttgtacgtcttcgaatcacgtgct atttgcaagtatgcgtgccgcaagagcaagccagagctgttgaaggaggg cgacatcaaggagtcagctatggtggatgtgtggctcgaggtggaggccc atcagtacaccgccgcgctgagccccattctcttcgagtgccttatccat cctatgcttgggggagccactgaccagacggtcatcgatgctaaccttgt taagatcaagaacgtgctggcggtgtacgaggcgcacctgagcaagtcca agtacctggctggagacttcctcagtcttgcggaccttaaccatgtgtct gtcaccctgtgcttggcggctacaccctacgcgtctctgttcgacgcgta cccgcatgtgaa
Download
page-top