Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ848690
Length 560 bp
Fasta Format > whsctal10k11
gcacattgcaagcacaagtgcaggcagctcgatcgcacgcactagcctgc acgctaccacctgctccgtcgcagatggccatggcacccagagcgctgct cctcctggccgtcgggctcatggtcgtggcctcggcgagcgcccacggcg gctacgaggggtcgtgccccagggacgggctgaagctgaaggcgtgcgtg gacgtgctgggcctgctcaagctcaaggtgaacgtgccgcgccatgagcc ttgctgctcgctcctcgacgggctcgtcggcttggacgcggcgctctgcc tctgcgcaaacatcgacgccaatgtgctcggcctcaacctccacctcccc gtcgacctccgcctcatcctcaacaactgcggcaaggtctgccccaccga tttccggtgcccaccacgccactgaaaggcgtctcgtctgaggaggatct tgatgttgtcctgtctgaatttttttagcgcggtttgtttatttcttggt acaattgatgtcgcaatcttttgttttcacttttctttttgttcccctta tgattaatca
Download
page-top