Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ848685
Length 615 bp
Fasta Format > whsctal10k01
gggatggcgcctatgaaggtgtacggctgggcggtgtcgccatggatggc gcgggtcctcgtctgcctggaggaggccggcgccgagtacgagctcgtgc ccatgagccgcaacggcggcgaccaccgccgcccggagcacctcgccaga aaccccttcggcgagatcccggtgctggaggacggcgatctgacgctcta ccaatcccgtgccatcgcaaggcatattctgcgcaaatgcaagcccgagt ttctaggagcgggcagcctcaaggagtcggcgatggtggacgtatgggtc gacgtggatgcccaccagcttgagcccgtactcaagcccatcgtgtttaa ctgcatcatcaacccgttcgtcgggagggacgtcgaccagggcctcgtcg atgagagcgtcgagaagctcaagaagctgctggaggtgtacgaggcgagg ctgtcaagcaacaagtacttggccggtgatttcgtcagcttcgccgacct cacccatttctccttcatgcgctatttcatggcgacggagcatgcagttg tgctcgatgcgtatccgcacgtaaaggcatggtgggaggcgctgctggca aggccgtcggtcaag
Download
page-top