Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ848678
Length 647 bp
Fasta Format > whsctal10i09
tagcggcgctgcaacctctccgccccctacgaagagagagaaaaccatgg cggcggtcggcggcgcgggcaacggagccggcgaggaggcaggcggggcg gagttctacctgcggtactacgtggggcacaagggcaagttcgggcacga gttcctcgagttcgagttccgccccgacggcaagctccgctacgccaaca actccaactacaagaacgacaccatgatccgcaaggaggtcttcgtctcc ccttccgtgctccgcgaggcgaggaggatcatccaggactcggagataat gaaggaggacgacagcaactggccggagcccgaccgcgtcggcaggcagg agctcgagattgtcatgggcaacgagcacatctccttcaccacctccaag atcggctccctcgttgacgtccagaccagcaaggacccggagggcctccg catcttctactacctcgtccaggaccttaaatgtttcgtgttttcactta tcaacctccactttaagatcaagcctattcaactttgagctctgtttggt tctcccggttgtgttgtggtactgcgagtgttagagaattctgtacttat gtaacatgcaatgagttgctcctggtgcggnttggtatgcgttgaag
Download
page-top