Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ848674
Length 664 bp
Fasta Format > whsctal10g15
atctctctgtggctagctagtgcgaaaggaagatggcgactaagctcgca gcgctcgtcgtcttggccgcgttcctcgccgggccggcggcgtccgaggc cgctagcatttgcttcaacggctggctgaggctacccacctacaacccgg tgctctgtcgccccacgccagacgttcagacgcggcagaggagacctgct ccctcggggtcagggctcacctccggctattacaacaccaggtgccctgg cgcggagaagatcgtcacggatgccgtgaagaaggccgtggatgcgaatc ctggcattggtgcggggctcatccgtctcttcttccatgactgcttcgtt cggggctgcgatggttccgtccttctcaacacgaccaactccaagaacag cgacacggagagggaaggccctcccaaccagaacagcctccgagggttcg aggtgattgacgaggccaaggcggcgatcgaggccgcctgccccgacaca gtctcatgtgctgacatcgtcgcctacgccgcccgcgacgcgtcctactt cctcagcgaccgcaagatcaacatccagatgccgggcggccgctacgacg gccgcgagtccttctccaacgagaccgaccagctgcccgggcccttctct aatctcacggcgct
Download
page-top