Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ848667
Length 665 bp
Fasta Format > whsctal10g01
atttcccccgaaggtcaagtcgtctcgtcccgtgttgcctttctcctcct ccccgcattcgccgtctgcggttcgcaccaccggacaagctcacacatca agacaataaatagagccttgtctgtttggggccaatcaaaccaaacaaca agttcatgtctgatctcgacgtccaggttccaactgcttttgatccgttt gctgaggcaaatgctgaggactccggcgctggtgctggatcaaagaacta tgtgcatgtgcgtgtccagcagcgcaacggaagaaagagtctgacaactg ttcagggtctgaagaaagactacagctacaacaagattctcaaggatctc aaaaaggaattctgctgtaatggtactgtagtccaggatccagaactagg ccaggtcatccaactccaaggtgatcagcgtaaaaatgttgctacttttc tagttcaggctggacttgcaaagaaagagagcatcaagattcacggattt taggcaacacacaaatgctcgtgtgctgtcaccgaagcctggaagttgtc gtatacttggtattgtcacatctaagacatttgaattgctagtactcgtg tgaggcatctgtgtttgatgcacttttacatccaagacatttgaatttgc atcggtgtgttgatg
Download
page-top