Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ848658
Length 463 bp
Fasta Format > whsctal10e05
atttttaacaatgttggaggttatgagggattgtttcttagtggcacgag gccagtctgggttatggtttgtcgacaacgatttcgggtgcatccacagc ttatgtgatggtcccattgaagcctttactgttctccacaatgtaaactg ntgtcatgggcttatatatgttacatcacagggttttctgaagatatgtc aactgcccgaagcatataactatgacaactactggcctgtccaaaagatc cctttgcatggtacccctcatcaggttacatattatgccgagcantctct gtatccacttatcgtgtctgttcctgttgttcgccccctaaatcaagttc tgtcaattatggctgatcaagatttggttcatcacatggataatgatgct acaagtgccgatgacctgcaaaaaacgtatactgttgaggaatttgaagt tcgcgtattagag
Download
page-top