Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ848655
Length 612 bp
Fasta Format > whsctal10c17
gccccgatgtcgagctcgtcgccgttaacgaccccttcatcaccaccgac tacatgacctacatgttcaagtatgacactgtccacggacagtggaagca ccatgaagttaaggtgaaggactccaagacccttctcttcggtgagaagg aggttgcggtgtttggctgcaggaacccagaggagatcccatgggctgct gctggtgctgagtacgttgttgagtccaccggtgttttcactgacaagga caaggctgcagctcacattaagggtggtgccaagaaggtcatcatttctg ctcccagcaaggatgctcccatgtttgtctgtggtgtcaatgagaaggaa tacaagtctgacatcgacattgtctccaacgctagctgcaccactaactg ccttgctcctcttgctaaggttatcaatgacaggtttggcattgttgagg gtttgatgaccacagttcatgccatgactgcaacccagaagactgttgat ggtccttccagcaaggactggagaggtggaagggctgccagcttcaacat cattccaagcagcactggtgccgcaaaggctgttggcaaggtgctcccag agcttaacggaa
Download
page-top