Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ848651
Length 607 bp
Fasta Format > whsctal10c07
tggagcctatgaaggtgtacggctgggcggtgtcgccatggatggcgcgg gtcctcgtctccctggaggaggccggcgccgagtacgagctcgtgcccat gagccgcaacggcggcgaccaccggcggccggagcacctcgccagaaacc ccttcggtgagatcccggtgctcgaagacggcggtctgacgctttaccaa tcccgcgccattgcaaggcatattctccgcaaacacaagcccgggcttct aggagcaggcagcctcgaggagtcggcgatggtggatgtatgggtcgacg tggatgcccaccagctggagcccgtactcaagcccatcgtgtggaactgc atcatcaacccgttcgtcgggagggacgtcgaccagggcctcgtcgatga gagcgtcgagaagctcaagaagctgctggaggtatacgaggcgagactgt caagcaacaagtacttggccggggatttcgtcagcttcgccgacctcacc catttctccttcatgcgctacttcatggcgacggagcatgcggttatgct cgatgcgtatccgcatgtgaaggcatggtgggaggcgctgctggcaaggc catcggt
Download
page-top