Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ848650
Length 615 bp
Fasta Format > whsctal10c05
ctcctcgcctccccgcggccacacctcgactcgctccctcgagtagatca tctgttccatccttttgaggcgagatggcggctaccttcaatgttaacgc tgaggcaggccttaaaaagcttgatggctaccttctgtctcgcagttaca tctctggataccaagcttccaaggatgacttggctgtgtattctgaattc tcagttgctccaccatcaacttgcaccaatgttgcaaggtggtacaatca cattgatgcactcctgaagctgagtggagttactgcccctggtcaaggtg tgaaggttctgtcatcagttgtccctgagacctcaactactgatgtggct gaggctcctgcagctgatgatgacgatgacagcgatgttgacctttttgg agaggaaaccgaagaggagaagaaggcagctgaagagcgtgctgccaaag ctaaggcttctaccaagaagaaagaatctggcaagtcatcagttttgctt gatgttaagccatgggacgatgagactgacatggtcaagctggaggaagc tgtccgaagcatcaagatggagggccttctgtggggtgcttccaagctca tgccagttggatatg
Download
page-top