Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ848642
Length 653 bp
Fasta Format > whsctal10a11
caatccacacccaatctcgtctccgatcgactcgagagctcgtcgaatcc tcctcccccatcgtctcaagatgcagatcttcgtgaagaccctcactggc aagaccatcactctggaggttgagagctctgacaccattgacaatgttaa ggctaagatccaggacaaggagggcattcccccggaccagcagcgcctga tctttgctggcaagcagctggaggacggccgcaccctggccgactacaac atccagaaagagtccacccttcacctggtgctccgcctccgtggtggtat gcagatttttgtgaagaccctcaccggcaagaccatcactctggaggttg agagctctgacaccattgacaatgttaaggctaagatccaggacaaggag ggcatttccccggaccagcancgcctgatctttgctggnaagcagctgga ggacggccgcaccctggccgactacaacatccagaaagagtccacccttc acctggtgctccgcctccgtggtggtatgcagatnttngngaagaccntc ancggcaagaccatnactctggaggttgagagctccnacacntngacaat gtnaaggccaagatccagacagganggcattccccggacancacgctgat ctt
Download
page-top