Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ848638
Length 657 bp
Fasta Format > whsctal10a03
agcagtgagcatccacttgcaaaagctatcttggattatgcatttcattt ccatttctttggcaaactcccctcatcaaaagatgacgttaagaaaagaa aagaagatgcattctctcaatggctcttggaagttgctgatttttctgcc ttgcctggcaaaggagttcaatgtttgatcaatgggaagatgattctggt gggcaaccgtgctttgatatctgaaaatggggttaacattcctgaagagg ctgaaagtttcttggtagacatggaattgagcgcaaagacaggcattctt gtagcatatgatggcgacttcattggattaatgggggtaaccgatccctt gaaaagggaggctgctgtagttatacaaggcctaaaaaagatgggcattt atccagttatggtgacaggggacaattggaggactgcactggcggttgca aaggagattggaattgaagatgtgagagcagaggttatgcctgccggaaa agccgacgtaatccgctctttccagaaggatgggagcgtggttgcaatgg ttggagatgggatcaatgattcccctgccctagcagcagccgacgtcgga atggccatcggtgcagggactgacatcgccatcgaggcagcagactatgt gctggtg
Download
page-top