Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ237565
Length 516 bp
Fasta Format > rwhe10f08
cggtgaggtataagctcgacacccattttcaaaggatctgaactgagctc taacaagtcggtgcatacgaaaatcagtaatattgctttaaaccccagct cagtttacagtataactatntaaagtaactcactggaaagatgggacacg agatgatgtcaattcagagggaatcctttcaacggaagtagacagatacg agtgggatgtcaacgtcattgtcatcatcatcctcgcaggccaccacaac atccagatggcgccgatacgatggcacctccatcttggccacctccctgg caacgtcgaccaccttcctgtccaaccgctccttgtgcctggggaacatg gagttgtacaggagcgacgtgccgcacgatatgctgtatgcgttcaaccc cttctccttgagccactccaggagctcccgtaacgtgatgttgcctgtta cggtccaccggtcccagaccgtccaggacaagtccttgtgcttgatggtc ttgggtgggaccggcc
Download
page-top