Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ237552
Length 649 bp
Fasta Format > rwhe10e10
cctttggcggcatatttttatattagtttgtctaattcacatctagatat tttttaagaatgtcacatctaaactcacacaaacatataatgcagcaata aaaaataggacaaaaaaattgaccacaaacagagtggacattagcttaga tgtcacatctagatgtgtcatatataaacctcagtttgtctaattcacat ctaaatgttttctaaggatgtcgcatctaaactctcacaaataaacgtaa caacaacaaacaaaataaagtaaaccacaaacataatgaacatcagatta gacgtgacataacatttagatgtgtcctacacacacctttctatgtactg agccccaaatattcatgtgattaatcaagagtctcgccctgcagctcgcg tcctgtgtcccgggggcagcatcttctgcctccggccccgtgtcggtcat gccgaacagactgcccatctcctccagcgtccggccgcgcgtctccggga gnacacgtgaagaagaacacccacgcgagcacggcgacgcccggcgtaga ggaagaaggttccgcccgagcgtgatggcgccggacagcgagaggaaggt catggacatgacgccgctccccacgcggttgccggccgccccgaccgcc
Download
page-top