Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ237533
Length 571 bp
Fasta Format > rwhe10d06
ataagatcaagctaaacacagagtcttcttcatgggcaataccaaaacag gacaccttaagcgcagcaacagtcaccgataacaagcaactaaaaatgta aagggttcgggtagtaataacggcagagaccgccctggcgcggccggccg gcctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaa cctctcctcgagcttggccttggcggccttggcggcgcccaccttcttgt ccttggaggtgagggagtcgggcgcgccggaggccacctccttgaggtcg acgtcgagggtatagcgggtgggcatgagatgggtgaagttgacgagctt gaggaacaccttgacgcgggacttcttggccgtcttcttggccgagtcct tgcggatcaccttcttcgggtacttggccagcccggcgacgaggcagtgc ccgtacgggcggtcgcgggtgccctcctcgaacacgcgcacgatcaccgc cttcttccccgcgtacctgccctgcagcaggatcaccgccttgccgggct tcaggaacttcaccatcttcc
Download
page-top