Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ208663
Length 554 bp
Fasta Format > wh10d09
attcggcacgagggcagttacggcgaactcgacatagtcaaggnatggga aagaaccatggaaataagaaagggctcaggtggtaagcacattgaaagga tcgacggttgacaacccgatctatctcagtgaccatgaaggtagaggcca gaggttaagagcctgtttggattccttccataaaaagcagcctaagccag gcacaaaccttaggcgtccgattttggaggcctgaggctgagatctctgc ctgagtaaagacctgcctgataggcctcaatccaaacaccccctaagatt gtgtagtgaaccatgcctttgtgagaggaccaagacaaaagttcaatgct gcatcgtttgcttgcttcctttgctcggttcgagatccaggccgggagta ggctaggaccagtgataagaacgtcagggtgttgcgtcatggctgtatac atgtgttgaaagcattgagcttaatttagatatgtaggtgcaattccttt tcgtgtataagataatgggtttatatataggctgtccatgatggaagttg aagt
Download
page-top