Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ211337
Length 137 bp
Fasta Format > wh30d21
ctgcaggcaattcggcacgaggcttccttcgattccctagtcatagcacc atactgatagctactcaatggcggcctccaagccccttgccctcctgctg ctcgtgactctgtccgcgacggccatgtctgccgccg
Download
page-top