Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ234001
Length 515 bp
Fasta Format > whe8c01
agctctcccgccggcgcaccggtctagcatcgccgtttacttgtcgagct ctccgtgaacngtggccccacaagagatgcgacacctccggcccgtcgcg ccgctccgggcactcgtcggcgtggtcaagtcctgctgtctccctcctct catggtggctgtcgtgtgcttggattcgcggccaagcaaacaagcagcgc tggccggcaaccaaccaagcaagcagtagcagcagcgccagcttgcgagg aagcaagcagcagcagcagcgtcggctatcaaggaagcaagcagcagcgc aagcggcaagcaggaagagcagcagcaccgccggcagcacgcgttggcag cggtggcgcgcggtagagagattggctgacggcagcacgtgcatgcgctg tggtggcgctggcagcagcggcgtctgtggcgtttttttttaatttctgc caacaagttttaccgagtgcgtcgctcggcaaaaacacctgtgacacgtg gcgaacctatgaatt
Download
page-top