Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ233856
Length 653 bp
Fasta Format > whe7i15
gaactccaccggcggcggcgcagcgcagcttgaggaaggaagcgaagatg gtgaagttcctgaagcccggcaaggcggtgatcctgctgcagggcaggta cgcggggaagaaggcggtgatcgtgcgcgtgttcgaggagggcacccgcg accgcccgtacgggcactgcctcgtcgccgggctggccaagtacccgaag aaggtgatccgcaaggactcggccaagaagacggccaagaagtcccgcgt caaggtgttcctcaagctcgtcaacttcacccatctcatgcccacccgct ataccctcgacgtcgacctcaaggaggtggcctccggcgcgcccgactcc ctcacctccaaggacaagaaggtgggcgccgccaaggccgccaaggccaa gctcgaggagaggttcaagaccggcaagaacaggtggttcttcaccaagc tccgcttctaggccggccggccgcgccagggcggtctctgccgttattac tacccgaaccctttacatttttagttgcttgttatcggtgactgttgctg cgcttaaggtgtcctgttttggtattgcccatgaagaagactctgtgttt agcttggatcttatgagatatgatgatgtttcatgtgttaaaatcatgtg aag
Download
page-top