Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ822916
Length 702 bp
Fasta Format > whatlal10d21
tgctgcctatctgcttgcttacctctctggcaacgccagcccctctgcag aggacctgacatccattcttgagtcaggtaattttgtcttactcggtggc ctacattagttttggtcctgctgttttcttctactgccaaagacatcttt ggatcctacagttgatgttatcagttattattatcattatgtgtttagca atagttacctacacttgaaatgtggcttaccaatagcaacctctgcctta agttctactgatatagtgtagaatatgcttagttttgtcacaagggatgt aatgtgttctttgttttctattgttagcttctaatcttacctgtacgcta tgttgcagttggttgtgaaattgacaatgagaagatggaactcatgctgt cccaagtgaagggcaaggacatcaccgagctcttggctgctggtagggag aagtttgctgcggttccatctggtggtggtggtgtggctgtttcagctgc tgcccctgctgctggaggtgctgctgcccctgcagctgagtcaaagaaag aagagaaggtcgtggagaaggaagagagtgatgatgtaagatcaccactc ccacctttccccttgttaggaccttctatcatctctatattaactggcct tgcagctcatgaacttggacatcatcattttttatgtgttttcattcatt tt
Download
page-top