Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ822912
Length 449 bp
Fasta Format > whatlal10d13
atccaaggcggaggtcgagatcaaagccaccggagatgaagttcttctcg gcgttcgacccgtggccggtgttcttccgccgggagtggggccgcacctg gcccttcctcgccggcttcgccgtcacggggaccctcatcaccaagatga ccgccggcttcaccgaggaggacctcaagaactccaagttcgtccaggcg cacaagaacaagtagtcgccgcccgcccggcccgtccgccgccaggtcac aggggcagcagctgagttaccggcatgtgtccttgatgcggcgagccaat ccccaccctcactattgtgattgaactttctgttttttgttcgaatccaa ctgcgtgcatttttgccgctctggtttgtaatgtaataagcgacatttga atcgtcgaatccaagaaaaaaaacggcttcggataaagtaaaaaaaaaa
Download
page-top