Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ822909
Length 659 bp
Fasta Format > whatlal10d05
acatccgtcnggtacccgacaagcccgatgatcangaggcacggcaacga nanatctgntgggncacgtcncgaccatgatgctggcgaccagtgagccc gtgcgagaggcacggcattctcaggtcggccacaccccgacaactangtt ctcggggttctgcangcccgtgtgggcaacacggcactcttcaacgaccc tcaacagctcggaggccatgaanagacgctcatgnggcggcaaggcctcg accgtgactctggcgaccatcnaggttgtgcaggaggcgcggtgctctat natcggccacgccgcaaccccgacncgctcggggtccatcgagtccgtgc gggaggcacaactcacgactgtcgggggagacccgacaagcaagtctgat gggaanagcaccaaggactccgctaccctgagaggagccactccggccag tgtggcgtccggnacaatgaccccnggaagggagttcccggacagtgcgg cgttcggcatgacgaccccaggaagggagttcctgggtagtgcgatgtcc aacaagtcatccccgggaanggagttcctgggtagcatgacgtcnaacac aacgaccccgggaaangagttcccgggcagtgtganatcaggaactacga ncccaggaa
Download
page-top