Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ822905
Length 702 bp
Fasta Format > whatlal10b19
gctcttcgtgctcgccgcctcccttcgcgtgctgcctcatggcttccatc gccggatctgccgtgtccttcgccaagcccgtcaaggcaatcaacacgaa ctcgctctctttctctggtccaaggaggggcaatgcatttcttcgcctgc agccagtgccgatgagatttgctgtttgctgctcagcaaagcaggataca gtggagaaggtttgtgaaattgttaagaagcagcttgctgttcctgaagg cactgaagtttgcggtaccaccaagttctctgaccttggagctgattcac tggacacggtcgagattgtgatgggcctcgaggaggagttccagatcagt gtggaggagacgagtgcgcaggcaattgcgacagttgaagatgctgccac gctcatcgacaagcttgtctctgcgaagtcatcttgaagggaggtcgtaa atcgtaatgattggagctcgtaagctagtagtcctaccttgggttgatcc ttgttgttctaccatagtcgttattatatggtgggttggtgattttctca ggactatcgtctcctgctgtgtgtaataagataattggttaagtatgtaa gctgttgaacatcgaagtgcctagttttcgtgcggctgtggtgcatgtat gcatcttttgtgcccaaaaggaagaatatgcgggtacaagccaaaaaaaa aa
Download
page-top