Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ822902
Length 679 bp
Fasta Format > whatlal10b13
atgcatgttacaggtgttggttgtggattcggactgtctctgattattgt ggacagagcaaaagctggtgataagcttgatcagcttgatatttatgatg gtgatgcctccaccccagtagaagagactgtggagccaaaggtgaccaag aaggcgcctgctagcgctaattccaagtccaacaagcggaagaaaaccaa ggacctctccgaatcagaagaggaggacgaggacgaggatgatagcgaag acgatgagaacggtgatgcgaggggtgcaaagggcaagcgtggccgcaaa ccatcgggcaggggcagaggcaggggagccaagaaggctaccccagagcc gaagtcgtctgggaggggcagaggccgcccgaagaaaactgagagcccgg ctgaaagctcgggacgaggtgggaagaggggccgaggcagaccccggaag tcttagacctctccggcgagcctttttggtgaaatcaggtcaagcgatat ctaacacctgatatgatgtgatccagcccggccattcgacagtactctct gactgcctgctattcgagagattttttccgtgtagtggtaatcttgtgat tgtgagcctgtaatgttagcatgcgcaaccgtattattcattggtgaccg tgagtgaatttttctgctcaaaaaaaaaa
Download
page-top