Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ822900
Length 623 bp
Fasta Format > whatlal10b09
agatcggtcgagccctccgccgccgccccgccttcagctctctccttcct tctccgatccaagatgaagttcattgctgcctatctgcttgcttacctct ctggcaacgccagcccctctgcagaggacctgacatccattcttgagtct gttggttgtgaaatcgacaatgagaagatggaactcatgctgtcccaagt gaagggcaaggacatcaccgagctcttggctgctggtagggagaagtttg ctgcggttccatctggtggtggtggtgtggctgtttcagctgctgcccct gctgctggaggtgctgctgcccctgcagctgagtcaaagaaagaaganaa ngtcgtggagaangaagagagtgatgatgacatgggcttcagtctgttcg actaagttgtggggcaccttgtgtctgaagtatctatccttggccaggaa actagagtcaatgatgttttagcctttatttagctgagttgtgaaacact ggcaagacaatgttttgatatgtaattcagcccctggttgctggttgatt tactggtgaaccatacctttgctatccaattttggtcctttaacaatgcg ttgttttgatgttaaaaaaaaaa
Download
page-top