Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ822898
Length 720 bp
Fasta Format > whatlal10b05
tgttctcaaccctccctccgtccgtcgcagctccagatttccttccccat ggctccgatcaagatcggcatcaatggtttcggccggatcggcaggcttg tggccagggttgcgctccagagccccgatgtcgagctcgtcgccgttaac gaccccttcatcaccaccgactacatgacctacatgttcaagtatgacac tgtccacggacagtggaagcaccatgaagttaaggtgaaggactccaaga cccttctcttcggtgagaaggaggttgcggtgtttggctgcaggaaccca gaggagatcccatgggctgctgctggtgctgagtacgttgttgagtccac cggtgttttcactgacaaggacaaggctgcagctcacattaagggtggtg ccaagaaggtcatcatttctgctcccagcaaggatgctcccatgtttgtc tgtggtgtcaatgagaaggaatacaagtctgacatcgacattgtctccaa cgctagctgcaccactaactgccttgctcctcttgctaaggttatcaatg acaggtttggcattgttgagggtttgatgaccacagttcatgccatgact gcaacccagaagactgttgatggtccttccagcaaggactggagaggtgg aagggctgccagcttcaacatcattccaagcagcactggtgccgcaaagg ctgttggcaaggtgctccca
Download
page-top