Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ822897
Length 494 bp
Fasta Format > whatlal10b01
agcggcgagagaactccgggagagggcggcgagatggtgcagcggctgac ataccgaaagcgccacagctacgccaccaagtcgaatcagactcgcgtcg tcnagaccccaggtgggaagcttgtctaccagtacaccaagaagcgggcg agtgggccaaaatgcccggttaccggcaagaagatccaaggaatcccaca cctgaggcctactgagtacaagaggtccagattgtcgaggaacaggagga ctgtgaaccgtccttatggtggtgttctgtctggtcctgcagtcagggag aggatcattagggcgtttttggtggaggagcacaagattgtgaagaaggt gcttaagatccagaagaccaaggagaagaccaccaagagctaaacaactg ggcgagataggcgtcgcggtgatgttttgtgtttctccgaatttgtttta agcaatcaagaattttctctcttgggatttgcagaaaaaaaaaa
Download
page-top