Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ822893
Length 512 bp
Fasta Format > whatlal10o11
aaaagtttgaggcggaaatttacgtccttaccaaggatgaaggtggtcgc cacactgcattcttctcgaattacagcccacaattctacttcaggacagc tgatatctgtgggaaaatcgagttgcctccggacgtgaagatggttatgc ctggtgacaacgtaaccgcaatctttgagttgatgttgcctgttccgctc gaaccaggtctaagattcgcgctgagggaaggagggaggaccgtcggcgc cggagttgtcgccaaagtcatgagctaataacaataatatgttccagacc tttctctttttttggcgtagtgaattttagcgaacaaatgaatgttgata tgaaggatttgtccgaccggaaacacgagataaacgagagtcgagagcaa ggggactggcatggatgcatcttgtgtggatgcattcagccaaccaactt cctacggataatggtttgttaccattccgaagaattgctattttttcttc tcaaaaaaaaaa
Download
page-top