Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ822889
Length 706 bp
Fasta Format > whatlal10m23
acctccaatcagaggtattctcaacggctgctgatggacagacaagtgtt gagattaatgtcctccagggagagagagagtttgtcagggacaacaagtc tcttggaagcttccgactggatgggatccctcctgcaccacgtggtgtac cacaaattgaagtgaagtttgacattgatgccaatggcattctgtcagta gcagctgttgataagggtactggaaagaagcaggatatcaccatcactgg tgctagtacactaccaaaggacgaggtcgagagaatggtagaagaagccg acaagtttgcccaggaggacaaagagaaaagagatgctattgacaccaag aaccaagcagactctgtggtgtaccagacggagaagcaactgaaggagct tggggacaaggtccctgctcctgtgaaagagaaggttgatgtaaagctcc aggaactgaaagatgccattgctggtggatcgacacagagcatgaaaact gccatggaggctttgaaccaggaggtaatgcagatcggacaggctatgta caaccaaactagtgccggtggtgctggctctactgatgctgaaactgagc ctggtgctggatcaacaagctcaggaaagggaccaaatgatggagatgtt atcgacgcggacttcacagatagcaattaaaggatggtcaagttatattc tgagtg
Download
page-top