Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ822884
Length 558 bp
Fasta Format > whatlal10m09
tcgtgatggagatcatcgtcaccttcgggctcgtctacaccgatgtacgc caccgccgccgaccccaagaaggggtccctcggcaccatcgctccaatcg ccatcggcttcatcgtcggcgccaacatcctcgtcgccggccccttctcc ggcgggtccatgaaccctgcacgctccttcggccccgccgttgccagcgg cgacttcaccaacatctggatctactgggccggcccgctcatcggcggtg gcctcgccggcgtcgtctaccggtacctgtacatgtgtgacgaccacacc gccgtcgccggcaacgactactaagccagccatgggaagatcattcggtc tttggtttccataatgtcttcggcaacataagaagtgcgtacgtggtggc actctcaggattgtctggatgatgtgaggaacgtcatgttgtttggttcc gatcgaaagcccgcgaggctgtggcacttggatgatgcatgtttctgtat ctgtactgtgatggatgttgtgaagttgttggggtttcaagattcttcaa aaaaaaaa
Download
page-top