Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ822883
Length 678 bp
Fasta Format > whatlal10m07
aaggaagaagcttcaggagagtgaagccatgcacactcaacatgagcagc aaattggaagtgcttctgagcctgctcgttccaaaatggtaacaagatta tcacataaacgggctatcttgctccaaggatcatcggacaatgacacaga cagacatcgctgtaaaaaacagaggtcctatccgcaggtgccaaatgacc caaccgctggccagcattcaggcagagatgacgaccaggaggtggttaga caaaagctgatcaaggggttctctgaaattgatggtgggcagtttattgg gataaagaaaatggggaaactaagtgagaagccattccgggatgcttgtg ctgtcaagctggcccctaaatatgctggcgcgaaatcttctgaactgtac accctgtggcaggaactactcgctagtccaaactggaaacccttcaaatc tgtcatagttgatggcaatcatcaggaggaggtcatagatgttgatgatg ataagctgcaaggactgaagatggcatggggagaaggaccctacaatgct gtcattagtgcattggttgagaggaaagagtacaacactgatggaacaga tgatgccttcgagctatggaactataaggaagggaggaaggccactcttg gggagtgtgttgactgtatcttggacaa
Download
page-top