Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ822878
Length 717 bp
Fasta Format > whatlal10k19
agaacgccgacactggtcgccaccatccagatccaggtccttcctcgtta tctttcaccatgccttcagcagcttcccgactcgtgcggatcggccgtgc cgctcgctcagctgcggcgaccacatctcgcttcgcccaattcgttgaag cagcgaccctctccacgaaggcggtggcgaccaaacctcacgctatctta ggttcagatcgtgccgcctccgtagatctgcgtatgaaccaatccactgt ccatgctcctccacgcgccatggcacctgcctccctgacactcagtcacc cagaagaacaaaggcaggaaggtaaggtgaagtttgtggtagaggagaaa gaccttgagtcagaagcagccctttgggccttgtatgagcgctggtgcaa agatttcaaccaaaagcgtgatcatgatgagatggttcactggttcaaca cattcaaggagactgtcctgcttgtccaccgtcggaacaatgctaatctg ccctacaaattgggaataaacaaattcgcggatgggaagctaaggaagct ctgttgctgtcatgatcctattcttaaaaagattgatgaggagtttggcg acaaaccaggtgaatttattctaggtgatggtgacaaacttctcaagcga gtcttcgctgattataaggtggttcatggcagactgtatgttcatttacc aaagggagttgatgtgg
Download
page-top