Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ822874
Length 564 bp
Fasta Format > whatlal10k11
cagcatcacaccagggtccaccgtaggagcaaggaagggagatccaccta acccaccaatggcggccgctgcttcctccagcgcgtggaaggcgaggtgg ctccgccccgaggcgtaccctatctttgcggcgacgggcgtggccgtggg gatctgcgtcatgcagctggtgcgcaacatcaccaccaaccccgaggtcc gggtgaccaaggagaacagggcggccggggtgctggacaaccacgacgag ggccgccgctacgcgcgccaccccttccggaggttcatcgacggcaagtc cgccgagatcatgcccggcatcaacagcttcttcaccgccccaccaaaga actagacgtcgttgtcgtcgccgtcggagagctctttcttcaacttgaag ggtggaatcaatcccttcgcgagaattacattcttttttccgcatgaatt caagtattattcgccatgattgattgtcaggcgctgtactatattgattt ttgtgatcatatataagtataaaacttgatctgaataatccctatgtctt gaacaaaaaaaaaa
Download
page-top