Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ822858
Length 568 bp
Fasta Format > whatlal10g23
tttgccgccgccgcccgttgccgcggacgcctcctcctcgccggcgagat gacgaagcgcaccaagaaggctggaatcgttggcaaatatggtaccaggt acggtgccagtcttcgtaagcagatcaagaagatggaggtctcccagcac tccaagtacttctgtgagttctgtggcaagtttgccgtgaagaggaaagc agtcggaatctggggatgcaaggactgcgggaaggttaaggccggtggtg cctataccatgaacactgccagtgcggtcactgtcaggagcacgatccgt cgcctgagggagcagactgaagcttgatcgcggtcgatctgaccaaggag cctttggattttgtagttcagacgagactcgtgcaacgctatgtagccta aattgacaacatacaatgttatttatcggcttgttgggttctgaaagtat ccggctacgctaaaatgtgtatctcgtttatcgtgcttagttgatcgtct gaaggtactctttgtgtgtgtcgttggttcttgaatcttgatgctattgt catctgttaaaaaaaaaa
Download
page-top