Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ822854
Length 710 bp
Fasta Format > whatlal10g13
atttactgagcgcacaattttgcaaatatttttggaggacgagatgaatg ctcctgctgggtctttaaaggatgtattggggttactgaggtctatgtat gttatggtgtgcatagatgaatctgcatcttttctgagatatggttattt gtcgcggaacaatgtaaccaccgtgaggaaagaagtcatgatactgtgca gtgaactcaggccccatgcgcttgctattgttggttctttcggaatccct gatgccttcctcagtccacttgctttcgactggatcgaagcaaatgctcg atcttccgggagagaatgaccatacaccttcagccaccaatgaggacgta gccccgtaaatgtgaaactattacagatggggcagccaaatacagattac aaaacaaagacagattcataatgcatttgctgcttcatgttgtttacaca gtttacaataatagttgttgaagtgtacagtcgaagatgctgatctgcgc agaaaatagggaatttgatgtatgcatcagttcatgtattgtcttctcta aattacgcaaataaaactgaataagctgatatggcccaacaggggctcac agcgtaaatagtggacacaatgttgtttgctgtaaattctttcttttttg acaatatgttgttgaaccgtacacaaagcaataagccagagccagtgcaa tatctgttgg
Download
page-top