Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ822850
Length 508 bp
Fasta Format > whatlal10g05
gagctcgattcaaatccaatcctgcgctacgtatcgcgcttcttccgtcc gtgcgttcgttccgaggccgagagtttgaggagatggccggcggcggtgt cgaggacgtctacggcgaggacagggccaccgaggagcagctcataacgc catggtcattctccgtcgcaagtgggcaccagcttctgagggacccccgg cacaacaaggggctggccttctccgaggcggagcgcgacgcgcactacct ccggggcctgctcccgccggccatcgtctcccaggagcaccaggagaaga agatcatgcacaacctccgcagttacaccgtgcccctgcaccgctacatc gccatgatggacctccaggagaggaacgagaggctcttctacaagctcct catcgacaacgtcgaggagctgctccccgtcgtctacacgcccgtcgtcg gcgaggcctgccagaagtacggcagcatctaccgccgcccgcaggggctc tacatcag
Download
page-top