Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ822832
Length 703 bp
Fasta Format > whatlal10c15
atggaataaaaattgaggacttgattgttgacatgccaacagaagtgcct aattctctgataggctttggttcttatgatactttcttactgggcttgtt ttattttattttgggaaaacccatgattttatcctaacccgaaattgctg aggtaggataagagtaatgggaatccaagcccaattctccattcaatgta cacaaaattactgatgcatctccatttcaatgtacacaaaattcagttgg agtagactccaaatctacaaatcattcttcctacaaaaagtagaaacaga gcctatcaacacaaccaaaacactcttttaactcttaaacttagcaagca gtaactatccagagtagttcttcagagctctatcgacacaaccagagtag ttcttcagagctctattcagcctgacatcaaagggagtcaagtatcgctt cagctttctatcctgcaacagataattaaagattgtcagaaggttgaagg tggaatcgaactccgagctcgaggccgctgcggtttagtggtgactggtc gcgcccgatctaggtaaaatcttcgtctgatttttggtccacacgacgat gatctgttttttcgggagtttcttcaggatccgctcgtgtgccagagccg gctcaggatgccttcctggacgatgacgaaacaagcttgaagcgagtgga gcg
Download
page-top