Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ822830
Length 260 bp
Fasta Format > whatlal10c11
gggccggcggcggcgcccgccgcgccatccaccagcctcgctagaagcta aacgagcgctgctgctgctgctgtgtagtgtaaccttcagttcagttcag ttgggttcagtctagtctctccctgcatctgtgtatacagctgaaaaatg aangggaaaacaaactgcaggcccctgcttgctagctagtgctctccctt cccttgtagctcccctcctcccgtgttcagaaatggtcaagaacaaaagc aaaaaaaaaa
Download
page-top