Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ822829
Length 132 bp
Fasta Format > whatlal10c09
cttgggcttcctggtgccctggttacttatgtaccgatcagcgaagtcct ggatcccatcattgttgatagcgtagagttagtgtatttgtgattgtgat atttatgagcagaatatcgttcaaaaaaaaaa
Download
page-top