Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ822824
Length 218 bp
Fasta Format > whatlal10a17
cgcgcacgcagaaagaaagaagcagcaccggagcgatagtaggatgcagc aatgattctttgattacacacgtagttcctgcacattttcccttccctct ttccactttgggctggacgaattttgtgcatcgttatcaaatttccgaca aatgtatctacttaatgaacagtcaatgcatgcaaacatatgaagaatat acctgtttaaaaaaaaaa
Download
page-top