Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ822823
Length 562 bp
Fasta Format > whatlal10a15
acccgagcgagcgccggccgaggaggaagagaaggtgagatggctcgcgg cgcggcggcggcggcagcggccgcgaagggcaagaagaaggggtccgtct ccttcgtgatcgactgcaccaagcccgtggaggacaagatcatggagatc gcgtcgctggagaagttcctccaggagcgcatcaaggtcgccggcggcaa ggccgggaacctcggcgactccgtcaccgtcacgcgcgacaagagcaagg tcaccgtcacctccgacggcgccttctccaagaggtacctcaagtacttg accaagaagtacttgaagaagcacaacgtgcgggactggcttcgtgtgat cgcagccaacaaggagcgcaacgtgtacgagctccggtacttcaacatcg ctgagaatgagggcgaggaggaggattagagtgcattgttatattgtagt gcttgttgagttttgatacttgatctgagtacctcctagttatccaccta tcttatgttgtgccccgttgaacctggatggtttaatttgaagaatcctt ataaaaaaaaaa
Download
page-top