Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ232614
Length 619 bp
Fasta Format > whe1d18
cgagggtttgctactgctggtgctcatcggactccccgacgccgccgtcg ccgccaacatggccgaggtctgcgtcaaggccgccgtcggccaccccgac acgctcggcgactgtcccttctcccagagggtgctgctcacgctggagga gaagaaggtgccctaccagatgaagctcatcgacgtcagtaacaaggccg actggttcctgaagatcaatccggagggcaaggtgcctgtgtataacggt ggtgatggcaaatggattgctgattctgatgtgatcactcaagtcattga ggagaagtacccaactccatcacttgtgacccctcctgagtatgcatcag tgggatcaaagatcttctccaccttcgtcacgttcttgaagagcaaggat gccagcgatggttcggagaaggcacttgttgacgagctgcaggcactcga agagcacctgaaggcccatggaccctacatcaacggggcgaacatctccg ccgtcgatctcagcctggctccgaagctctaccacctccaggtcgccctg gagcacttcaagggctggaaggtccctgaaaccctgacccagcgtccatg cctacaccgaggctctctt
Download
page-top