Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ235965
Length 315 bp
Fasta Format > whe19e03
cccccaacccaccggcggcggcgcagcgcagcttgaggaaggaagcgaag atggtgaagttcctgaagcccggcaaggcggtgatcctgctgcagggcag gtacgcggggaagaaggcggtgatcgtgcgcgtgttcgaggagggcaccc gcgaccgcccgtacgggcactgcctcgtcgncgggctggccaagtacccg aagaaggtgatccgcaaggactcggccaagaagacggccaagaagtcccg cgtcaaggtgttcctcaagctcgtcaacttnacccatctcatgcccaccc gctataccctcgacg
Download
page-top