Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ210717
Length 558 bp
Fasta Format > wh29f12
ttcgctcctctcctctccgtnctccccaaatccatcctagggttttactt tcccctccgacaaggttttacccccgcgccccgccaccatgaccgccgcc gagctgcaggcggagctgctccgcgcccagctcgaggaccacgacatcga gggagatgagcctatcgttgaggatgatgatgacgacgatgaagacgatg atgaggatgaggatgaaaaagatgacgatgacgttgcgggaggtgatgct agtggaagatctaggcagagtaggagtgagaagaagagcaggaaagccat ggagaagcttggcatgaaggtcattactggtgtgagccgtgtaactatca agaagaacaagagcgttatgtttgtcctctccaagccagatgtcttcaag agctcaaactcagatacctacgtcatgttcggggaggccaagattgagga cctgagcactcagctgcattcacaagcggcggagcagttcaaggcgccga gcccaagcagcgtcatcttgaagggcgagccgtccatggcagcagcccat gacgacga
Download
page-top