Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ209012
Length 509 bp
Fasta Format > wh12b24
ggaacgttccaaagaccaagaagacctactgcaagaacaaggtagtgcaa gaagcacaccctccacaaggttacgcagtacaagaaaggcaaggacagtc tttctgctcagggaaagcgccgttacgaccgcaagcagtcaggatatggt ggccagacaaagcctgttttccacaagaaggccaagacaacaaagaagat tgtgctgaagctgcagtgccagagctgcaagcattactcgcaacgcgcta tcaagaggtgcaagcactttgagatcggtggagacaagaagggcaagggg acctctctcttctaagctgatgatatccctgttttgttcagtgttgtgcc agaacttcccactcgaacaatgtattagtatcatattggtattctgggta taactgtatgggctatggagcatatgttttgcctttcctgtcaacgactc tcttcagatccttgagacaagtaaaaatgttctttctgcttttgagttca aaaaaaaaa
Download
page-top