Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ235227
Length 606 bp
Fasta Format > whe15k18
tgcaggnaattcggcacgaggcacagnacccctcccctcccctcccctcc cccaacccaccggcggcggcgcagcgcagcttgaggaaggaagcgaagat ggtgaagttcctgaagcccggcaaggcggtgatcctgctgcagggcaggt acgcggggaagaaggcggtgatcgtgcgcgtgttcgaggagggcacccgc gaccgcccgtacgggcactgcctcgtcgccgggctggccaagtacccgaa gaaggtgatccgcaaggactcggccaagaagacggccaagaagtcccgcg tcaaggtgttcctcaagctcgtcaacttcacccatctcatgcccacccgc tataccctcgacgtcgacctcaaggaggtggcctccggcgcgcccgactc cctcacctccaaggacaagaaggtgggcgccgccaaggccgccaaggcca agctcgaggagaggttcaagaccggcaagaacaggtggttcttcaccaag ctccgcttctaggccggccggccgcgccagggcggtctctgccgttatta ctacccgaaccctttacatttttagttgcttgttatcggtgactgttgct gcgctt
Download
page-top