Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ232332
Length 562 bp
Fasta Format > whe12c01
tgcaggnaattcggcacgaggagcctagctctcccgccggcgcaccggtc tagcatcgccgtttacttgtcgagctctccgtgaaccagtggccccacaa gagatgcgacacctccggcccgtcgcgccgctccgggcactcgtcggcgt ggtcaagtcctgctgtctccctcctctcatggtggctgtcgtgtgcttgg attcgcggccaagcaaacaagcagcgctggccggcaaccaaccaagcaag cagtagcagcagcgccagcttgcgaggaagcaagcagcagcagcagcgtc ggctatcaaggaagcaagcagcagcgcaagcggcaagcaggaagagcagc agcaccgccggcagcacgcgttggcagcggtggcgcgcggtagagagatt ggctgacggcagcacgtgcatgcgctgtggtggcgctggcagcagcggcg tctgtggcgtttttttttaatttctgccaacaagttttaccgagtgcgtc gctcggcaaaaacacctgtgacacgtggcgaacctatgaatttccaccgt tttcatctgccg
Download
page-top