Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ231998
Length 481 bp
Fasta Format > whe10i06
ggggttcccagccccaacttnctccgccgccgccatgtaatcctctccga cctcgcctggagcagccagcaagatgccgccgccgtggccgcctctctcc cttctctcctctttttccctacctttctctctcctctaaagtctaaactg tgtgcaggtcctctccacaggtgctgccatggccgtgtcatggagctcgc ccccgtgggatgcatgcccctccaatgacgccctgtccaggtcctctgga tcccgatttgagtgtgttattttgcgtccgatcctgatttggacggcatt ttttgaggcaccgcgagcgcgctggacggcaaaaagggttgcgtcaagga gcgacgcattgttgtaagcctgtagcacaccattgttgctactcccacct cgatggtctatctcatgggttgcagataggatgtgatattctgcagcgtg gacatcgcctancaatcagatttgatgttga
Download
page-top