Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ231995
Length 664 bp
Fasta Format > whe10i01
aggaattcggcacgagggggattttagcctcagcgccgccgccgccgccc cccagcgaattcgacaagcccccgagctcgccggatccgatggccgtcac gttctccgacctccacaccgccgacgggctcaaggccctcgaggcgcacc tcgccggcaagacctacatctccggcgatgggatcaccaaggacgacgtc aaggtgttcgcggcggtgcccgtgaagcccagcgccgagttcccgaacgc tgcccgctggtatgacaccgtcgccgcggctgttgctccaaggttccctg gccagtcctctggggtgagtgcatcatcggctcctgctgcagctgctcct gccgcttccaaggatgaagacgaggatgatgacatggatctgtttggcga tgagaccgaggaggacaagaaagctgcagctgagcgtgaggctgccaagc ctgcaaagaagaaagaaagtggcaaatcctctgtcctcatggacatcaag ccatgggacgatgagactgacatgaagaagttggaggaggctgtccgcag tgttcaaatggagggtctcacctggggtgcatctaagcttatgcctgtgg gttatggcatcaagaagctccagatcatgctgacgatcattgacgacctc gtgtctgtcgacac
Download
page-top