Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ231992
Length 345 bp
Fasta Format > whe10h15
cccccgaagcagcgtgcgcgtcgctcctctccgcccggatcgcgatggcc gccgccgccgtcgncgccgactccaagatcgacaacctccgcgacgccgt cgccaagctcggcgagatcagcgagaacgagaagtccgggttcatcagcc tcgtctcgcgctacctgaggggcgaggcggagcagatcgagtggagcaag atccagacccccaccgatgaggtggtggtgccctacgacaccctcgcgcc ccctcccgaagatctcgacgccatgaaggccctgctcgacaagctcgngg ngctcaagctcaacggaggcctcggnaccaccatgggctgcaccg
Download
page-top